Search results
Tian-Yun Wang currently works at the Deaprtmen of Biochemistry and Molecular Biology, Xin Xiang Medical University. Tian-Yun does research in Molecular Biology, Cell Biology and Biotechnology.
Tian-Yun Wang. expand_more. Works (50 of 96) sort Sort. Items per page: 50. Page 1 of 2. Recombinant therapeutic proteins degradation and overcoming strategies in CHO cells. Applied Microbiology and Biotechnology.
Jul 1, 2020 · Wang XY, Yi DD, Wang TY et al (2019) Enhancing expression level and stability of transgene mediated by episomal v ector via buffering DNA methyltransferase in transf ected CHO cells.
- Vector Construction
- Cell Culture and Transfection
- Fluorescence Microscope and Flow Cytometry
- Bacterial Culture and Transformation
- Western Blot
- Statistical Analysis
As previously reported , eGFP coding gene which was amplified from the pEGFP-C1 vector (Gene bank: U55763) by polymerase chain reaction (PCR) amplification (primers F1: CCGGCTAGCATGGTGAGCAAGGGCGAGGAG; R2: CTAACCGGTTACCACTCGTTCCCGCTCCTCG) was cloned into pIRES-neo vector (Genebank no. U89673.1) (Clontech, Mountain View, USA) (Fig. 1a) at the Nhe I a...
CHO-S cells (#A11557-01; Life Technologies) were incubated in Dulbeccoʼs modified Eagleʼs medium (DMEM) + F12 (Proteineasy Biotech Company, Xinxiang, China) supplemented with 10% fetal bovine serum (Proteineasy Biotech Company, Xinxiang, China) and 1% penicillin and streptomycin (Proteineasy Biotech Company, Xinxiang, China), in a humidified incuba...
At 24 h post‐transfection, the eGFP expression was observed by the inverted fluorescence microscope (Olympus, Tokyo, Japan). After 48 h of transfection, the cells were digested with 0.25% trypsin and seeded in 12.5 cm2 cell flasks, the mean fluorescence intensity (MFI) of eGFP in each sample was analyzed by flow cytometry when the cells reached 80–...
pIRES-EGFP and pIRES-CMV/T7-EGFP were transformed into E. coli BL21 followed by incubated on ice for 30 min, heat shock at 42 °C for 90 s and then incubated on ice for 2 min. The bacteria were cultured in the Luria Bertani broth medium (LB) agar plates with 100 μg/mL ampicillin and incubated the plates overnight (16 h) at 37 °C. For the expression ...
After cultured in LB media with 100 μg/mL ampicillin for 6 h, bacteria were harvested by centrifugation and resuspended in PBS. The eGFP expression was observed by an inverted fluorescence microscope. The resuspended bacteria were sonicated and centrifuged for 5 min at 12,000 rpm. The supernatant was collected and boiled with 5 × SDS sample buffer ...
Data were reported as means ± standard deviations. All experimental data were analyzed with the T test using SPSS 18.0 software (SPSS Inc., Chicago, IL, USA). Differences with P values < 0.05 were considered statistically significant.
- Dan-Dan Yi, Xiao-Yin Wang, Wei-Li Zhang, Meng Wang, Jun-He Zhang, Tian-Yun Wang
- 2020
Jul 4, 2022 · The productivity of dihydrofolate reductase (DHFR) deficient CHO cell can increase with gene copy number amplification ( Yeo et al., 2017 ), which is commonly used for RTPs production. In general, the factors that affect product quality depend on the type of RTPs and the rCHO cell line used.
Ash Is the Purest White (2018) HKMDB contains information about films, people, and companies associated with Hong Kong cinema.
Tian-yun Wang wtianyuncn@126.com. Department of Biochemistry and Molecular Biology, Xinxiang Medical University, Jinsui Road, Xinxiang 453003, Henan, People’s Republic of China.
